In summary, we show here that two metabolites from the same biosynthesis pathway in gut bacteria act on mammalian host cell proliferation in opposing ways. PreQ1 incorporation in cognate tRNAs leads to their depletion, with the consequence of reducing translation of the housekeeping genes required for proliferation. The preQ1 and translation-dependent tRNA quality control through the ER-resident protein IRE1 represents a very mild stress condition that causes persistently slowed translation at specific codons, which in turn exacerbates the degradation of preQ1-modified tRNAs.
Sample sizes were determined based on standard practice in the field, statistical analysis consideration, feasibility and previous publications. No statistical method was used to predetermine sample size. No data were excluded from the analyses. The experiments were not randomized. The investigators were not blinded to allocation during experiments and outcome assessment. Data acquisition and analysis were not performed blind to the conditions of the experiments, but were carried out using automated and standardized protocols to minimize bias. The data distribution was assumed to be normal, but this was not formally tested.
HEK293T cells (ATCC, CRL-3216) were maintained in 37 °C in a humidified incubator with 5% CO in complete Dulbecco's modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum (FBS; Thermo Fisher) and 1% pen/strep (Thermo Fisher). To obtain queuosine-deficient 0Q HEK293T cells, the cells were cultured using complete DMEM containing 10% dialysed FBS (Thermo Fisher) and 1% pen/strep for 2-3 weeks. Queuosine modification levels were measured by APB (Frontier Scientific)-gel-based northern blot analysis.
MEFs (ATCC, SCRC-1040) were cultured in a 37 °C incubator with 5% CO using complete DMEM with pyruvate (ATCC) containing 10% FBS and 1% pen/strep. 0Q MEFs were obtained in the same way as HEK293T cells by culturing MEFs with dialysed medium for 2-3 weeks and verified as above.
B16-OVA cells (A. Sharpe laboratory, Harvard Medical School) were cultured in a 37 °C incubator with 5% CO using DMEM with pyruvate (Thermo Fisher). 0Q B16-OVA cells were obtained and verified as described for HEK293T cells.
BMDCs were generated from 6-8-week-old female C57BL/6 mice. Bone marrow cells were collected from femora and tibiae and plated at 1 × 10 cells per well in a flat-bottom, non-tissue culture-treated 96-well plate (GenClone) in 150 µl of complete RPMI-1640 (Thermo Fisher) supplemented with 10% (vol/vol) dialysed FBS (Thermo Fisher), l-glutamine (2 mM Thermo Fisher), pen/strep (Thermo Fisher), MEM non-essential amino acids (Corning), HEPES (10 mM; Thermo Fisher), sodium pyruvate (1 mM; Corning) and β-mercaptoethanol (55 µM; Thermo Fisher). Recombinant murine granulocyte-macrophage colony-stimulating factor (GM-CSF; 15 ng ml; Peprotech) was added to the complete RPMI medium.
Female C57BL/6J mice (wild-type) were obtained from the Jackson Laboratories or Charles River Laboratories; 6-12-week-old mice were used for the study. Animals were housed in specific pathogen-free (SPF) conditions at The University of Chicago, and all experiments were performed in accordance with the US National Institutes of Health Guide for the Care and Use of Laboratory Animals and approved by The University of Chicago Institutional Animal Care and Use Committee (study protocol # ACUP 72519).
For linearity curve and quantification of queuine and preQ in plasma in group 2, five female C57BL/6J mice were obtained from Charles River Laboratories. The blood was collected by decapitation and further processed for plasma collection. For quantification of queuine and preQ in liver tissue in group 2, four male C57BL/6J mice were obtained from Charles River Laboratories. The liver was collected and snap-frozen in liquid nitrogen. Animals were housed in SPF conditions at the IRCM in Montpellier (study protocols #28453 and #15684). All experiments were performed according to European Union Council directive 86/609EEC and institutional/local guidelines on laboratory animal usage. Mice were euthanized at 12 weeks of age.
Housing conditions for the mice were as follows: light cycles, 12 h light/12 h dark, with lights on at 6:00 and off at 18:00. Temperature and humidity were within the Guide for the Care and Use of Laboratory Animals recommended ranges, which are 68-79 °F and 30-70%.
Queuine dihydrochloride was synthesized by Synthenova SAS using the protocol from ref. . Its purity was determined at 99% by high-performance liquid chromatography (HPLC) analysis. preQ dihydrochloride was purchased from Sigma-Aldrich (SML0807).
The synthesis scheme is shown in Extended Data Fig. 1b. preQ was synthesized by catalytic reduction of the nitrile function of compound 1 in the presence of ammonia under hydrogen pressure before being deprotected in an acid medium. Nitrile 1 was formed in two stages. Before being tritylated in position 2, the pyrrolopyrimidinone bicycle was obtained by reacting methyl 2-cyano-2-formyl acetate 2 and 2,6-diaminopyrimidin-4-one 3 according to ref. . The queuine itself was obtained by deprotection in an acid medium of compound 4 resulting from a reductive amination reaction between amine 5 and aldehyde 6. Aldehyde 6 was produced by reduction of nitrile 1 with Dibal-H. The modified nucleosides queuosine and preQsine were obtained after several deprotection steps following the reductive amination reactions of the respective amines 5 and benzylamine with aldehyde 8. The latter was synthesized by glycosylation of aldehyde 6 using 1-acetyl-2,3,5-tribenzoyl-ribose. Finally, we synthesized 'heavy queuine' by introducing three N isotopes into its formula. The heavy queuine was isolated after a final deprotection step that followed a type 2 nucleophilic substitution of brominated compound 9 by the heavy amine preQ. Heavy preQ was formed in several steps from N-2,6-diaminopyrimidin-4-one 10 by an intermolecular cyclization reaction between methyl 2-cyanoacetate 11 and commercial N-guanidinium chloride 12.
Each mouse tissue was crushed with 1× phosphate buffered saline (PBS), then 100 µl of homogenized mixture was taken for the extraction of metabolites. A 450-µl volume of methanol/water buffer (ratio 8/1) previously cooled to -20 °C and 1 µl of 10 µM queuine-N15 were added. The samples were incubated with orbital agitation at 4 °C for 20 min, then centrifuged at 16,000g at 4 °C for 5 min. The supernatants were filtered with a Captiva EMR-Lipid plate (Agilent) to remove phospholipids. The samples were dried in vacuum and resuspended in 5 mM ammonium acetate pH 5.3 (group 1) or 0.5% of acetic acid (group 2) before LC-MS/MS analysis.
Animals were euthanized by guillotine, and blood was collected directly into a 50-ml Falcon tube containing 10 µl of heparin. The total blood volume was measured, and the sample was transferred to 2-ml or 1.5-ml Eppendorf tubes. A STOP solution (ethylenediaminetetraacetic acid (EDTA) + adenosine-5'-O-(3-thiotriphosphate) (AOPCP) + nitrobenzylthioinosine (NBMPR) + dipyridamole + 5-iodotubericidin + erythro-9-(2-hydroxy-3-nonyl)adenine (EHNA)) was added to the blood in a 2:1 ratio (two volumes of blood to one volume of STOP solution). The blood sample was then centrifuged at 215g (1,600 r.p.m.) for 10 min. Plasma was aliquoted into 50-µl portions in 0.5-ml Eppendorf tubes, flash-frozen in liquid nitrogen, and stored at -80 °C for further analysis. For group 1, 50 µl of plasma in 450 µl of methanol/water buffer (ratio 8:1) previously cooled to -20 °C and 1 µl of 10 µM queuine-N15 were combined. The samples were incubated with orbital agitation at 4 °C for 20 min, then centrifuged at 16,000g at 4 °C for 5 min. The supernatants were filtered with a Captiva EMR-Lipid plate (Agilent) to remove phospholipids. The samples were dried in vacuum and resuspended in 5 mM ammonium acetate pH 5.3.
For the LC method, 5-µl samples were separated by reverse-phase ultra-performance liquid chromatography (Nexera LC-40 system, Shimadzu) on a C18 column (Synergi Fusion-RP; 4-µm particle size, 250 mm × 2 mm, 80 Å, Phenomenex). The mobile phases consisted of 5 mM ammonium acetate pH 5.3 (solvent A) and pure acetonitrile (solvent B). The 30-min elution gradient started with 100% phase A followed by a linear gradient to 8% solvent B at 13 min. Solvent B was increased further to 40% over 10 min. After 2 min, solvent B was decreased back to 0% at 25.5 min. The initial conditions were regenerated by rinsing with 100% solvent A for an additional 4.5 min. The flow rate was 0.4 ml min and the column temperature was 35 °C.
For the MRM method, nucleoside detection was performed using a Shimadzu TripleQuad NX8060 system in positive ion mode. The MRM transitions used for detection of multiple targets are described in ref. and Supplementary Tables 1 and 2. MS was carried out in dynamic MRM mode with a retention time window of 3 min and a maximum cycle time set at 297 ms. Peak area integration and calibration curves were performed using Skyline 24.1.0.199 software (MacCoss Lab Software).
For the LC method, 5-µl samples were separated by reverse-phase ultra-performance liquid chromatography (Nexera LC-40 system, Shimadzu) on a C18 column (Synergi Hydro-RP; 4-µm particle size, 250 mm × 2 mm, 80 Å, Phenomenex). The mobile phases consisted of 0.5% of acetic acid (solvent A) and pure acetonitrile (solvent B). The 30-min elution gradient started with 100% phase A until 3 min, followed by a linear gradient to 8% solvent B at 13 min. Solvent B was increased further to 40% over 10 min. At 23 min, solvent B was increased to 80. After 7 min, solvent B was decreased back to 0%. The initial conditions were regenerated by rinsing with 100% solvent A for an additional 5 min. The flow rate was 0.4 ml min and the column temperature was 35 °C.
For the MRM method, nucleoside detection was performed using a Shimadzu TripleQuad NX8060 system in positive ion mode. The ESI source settings were set as described in Supplementary Table 1 and the MRM transitions are described in Supplementary Table 2. Peak area integration and calibration curves were performed using Skyline 24.1.0.199 software (MacCoss Lab Software).
RNA was extracted from human stool samples and prepared for MSR-seq as previously described. Briefly, samples were deacylated without periodate. After the first ligation reaction, the samples were split into two parts. One aliquot was treated with AlkB demethylase, and the other was treated with the same solution without AlkB (mock). Both samples were again split into two equal parts; one set of aliquots were treated with sodium periodate as previously described for PAQS-seq, and the other set of aliquots was untreated. These four samples were then used in reverse transcription following the usual MSR-seq protocol.
0Q HEK293T, MEF or B16-OVA cells in 10-cm/15-cm plates were grown to 80% confluency and collected with 0.25% trypsin (Trypsin). Cells were counted using trypan blue stain (Thermo Fisher) and a cell counter (Thermo Fisher Countess II) by following the manufacturer's manual. For each queuine (Toronto Research Chemicals) and/or preQ (Cayman Chemical) treatment, 6-ml samples of a 5 × 10 cells ml mixture were prepared in 15-ml conical tubes. Queuine and/or preQ was added to the indicated final concentrations. Eight replicates of 100-µl cell mixtures from each condition together with medium-only control were then transferred into 96-well plates. Six plates of cells were prepared for six-day measurements (day 0 to day 5). All cells were incubated at 37 °C for 2 h to allow the cells to adhere to the bottom, then 10 µl of CCK-8 reagent (Dojindo) was added to each well of the 'day 0' plates using multichannel pipettes, followed by incubation at 37 °C for 2 h. Absorbance at 450 nm was measured using a Synergy Neo microplate reader (BioTek). On days 1 to 5, absorbance at 450 nm was measured at the same time of each day.
For measurement of a cell's ability to proliferate after preQ treatment, 0Q HEK293T cells were cultured in a 37 °C incubator with 5% CO using complete DMEM (10% dialysed FBS and 1% pen/strep). preQ was added to the medium at 72 h, 48 h, 24 h and 0 h to a final concentration of 1 µM before collection of cells. Cells were then collected at the same time using 0.25% trypsin and counted using trypan blue stain and a cell counter. The cell concentration and percentage of live cells were recorded.
For the proliferation rescue experiment with variable queuine concentrations, 0Q HEK293T cells were cultured to 60-70% confluency, then treated with 1 µM preQ for 24 h. Cell mixtures at 5 × 10 cells ml with 1 µM preQ were prepared and transferred into 96-well plates as above. Absorbance at 450 nm was measured as above on days 0 to 2. Queuine was added to day 3 to day 5 96-well plates on day 2 to final concentrations of 0 nM, 1 nM, 10 nM, 100 nM and 1,000 nM. Absorbance at 450 nm was measured as above on days 3 to 5.
For proliferation with different percentages of fully Q-modified cells, two plates of 0Q HEK293T cells were cultured to 60-70% confluency followed by treatment with sterile HO or 1 µM queuine for 24 h to obtain 0Q cells or fully Q-modified (100Q) cells. 0Q and 100Q cells were collected using 0.25% trypsin and counted as above. 0Q cells and 100Q cells were then mixed to obtain 0%, 25%, 50%, 75% and 100% 100Q cells. The mixed cells were then used to perform a cell proliferation assay as above under 1 µM preQ. 0Q cells without any treatment were used as control.
For proliferation with treatment of different concentrations of the IRE1 ribonuclease inhibitor 4µ8C, 0Q HEK293T cells were cultured to 80% confluency. Cells were then collected using 0.25% trypsin and counted using trypan blue stain. Sterile HO or 4µ8C was added to each set of the 15-ml conical tubes to 0 µM, 10 µM or 50 µM final concentrations. Sterile HO or preQ was then added to 0 nM or 1,000 nM final concentration. A proliferation assay was then performed as above.
BMDCs were obtained and cultured as described above. All treatment conditions were plated in quintuplicate in a 96-well plate. Cells were fed at days 2 and 4 with 50 µl of complete RPMI medium (Thermo Fisher) containing GM-CSF (Peprotech). Queuine and/or preQ were added as required to maintain the initial treatment concentration.
Live cells were counted each day at the same time. Cells were resuspended and transferred into a 96-well V-bottom plate (Sarstedt). To loosen adherent cells, 100 µM or 10 mM EDTA (Thermo Fisher) in 1× dPBS (Thermo Fisher) was added to a flat-bottom plate, which was then warmed at 37 °C for 10 min. Following incubation, the cells were resuspended and transferred to the corresponding well of the V-bottom plate. A final wash using 50 µl of 1× dPBS was used to transfer any remaining cells from the flat-bottom plate to the corresponding wells in the V-bottom plate. Immediately before data acquisition, the V-bottom plate was centrifuged at 189g (1,500 r.p.m.; 4 °C) for 5 min, supernatant was removed, and the pellets were resuspended in 130 µl of Magnetic-Activated Cell Sorting (MACS) buffer (Miltenyi Biotec) with 0.1 mg ml 4',6-diamidino-2-phenylindole (Biotium). Flow cytometry was completed using a NovoCyte Penteon system and NovoExpress software (Agilent), and data analysis was completed using FlowJo.
Flow cytometry was performed at the Cytometry and Antibody Technology Facility at the University of Chicago.
QTRT1, QTRT2 and control shRNA lentiviral particles were obtained from Santa Cruz Biotechnology. The manufacturer's manual was followed to obtain QTRT1 and QTRT2 stable KD cell lines. Briefly, 1 × 10 HEK29T 0Q cells were plated into each well of a 12-well plate 24 h before viral infection. After 24 h of incubation, the medium was replaced with complete medium containing 8 µg ml polybrene (Santa Cruz). Lentiviral particles were thawed at room temperature and used promptly. Corresponding amounts of QTRT1 or QTRT2 lentiviral particles were added to each well to infect the cells at a multiplicity of infection of 1, 5 and 10. The infected cells were incubated for 48-72 h. The culture medium was then replaced with complete DMEM containing 5 µg ml puromycin (Santa Cruz) to select stable clones expressing the shRNAs. The transduced cells were continuously incubated with puromycin-containing medium for a few days and split 1:3 to 1:5 when necessary until the cells without virus transduction were completely dead. Stable KD cells were stocked and collected for protein expression test by western blot after the cells had been sufficiently expanded using QTRT1 (Santa Cruz, sc-398918, 1:200), QTRT2 (Santa Cruz, sc-377384, 1:100), cyclophilin B (Abcam, ab178397, 1:2,000) and vinculin (Santa Cruz, sc-73614, 1:1,000) antibodies.
Proliferation assays with QTRT1 and QTRT2 stable KD cells were performed as above using 0Q QTRT1 or QTRT2 and shRNA control KD cells. Proliferation was done under the queuine and preQ concentrations indicated in Fig. 2.
Western blots were performed as previously reported. Briefly, equal amounts of total protein lysate from each sample were boiled and reduced at 95 °C for 5 min and loaded onto a sodium dodecyl sulfate (SDS)-PAGE gel (Thermo Fisher). The samples were then transferred to polyvinylidene fluoride (PVDF) membrane (Millipore) using a Bio-Rad semi-dry transfer system (Trans-Blot Turbo Transfer System) or wet transfer cell (Mini Trans-Blot Electrophoretic Transfer Cell). The membrane was then blocked using 5% (wt/vol) non-fat dry milk (Bio-Rad) in 1× Tris-buffered saline with Tween 20 (TBST; National Diagnostics) overnight at 4 °C. The membrane was then washed three times with 1× TBST for 10 min each. The membrane was then sliced into several strips to blot target proteins at different molecular weights. The membrane strips were incubated with control or target antibodies in 1× TBST with 5% (wt/vol) non-fat dry milk at 4 °C overnight. After primary antibody incubation, each membrane strip was incubated with corresponding secondary antibodies in 1× TBST with 5% (wt/vol) non-fat dry milk at room temperature for 30 min. The membrane strips were washed three times for 10 min each and detected using enhanced chemiluminescence (ECL) substrate (Bio-Rad) and the Bio-Rad ChemiDoc and Image Lab.
Blot stripping and reprobing were performed using a low-pH protocol as previously reported. Briefly, the membrane strips were incubated with stripping buffer (0.2 M glycine-HCl, 0.1% SDS, 1% Tween 20, pH 2.2) for 30 min at room temperature. The membrane strips were then washed three times with agitation for 10 min each in 1× TBST buffer. The membrane strips were blocked with 5% (wt/vol) non-fat dry milk in 1× TBST buffer before reprobing.
PreQsine has a primary amine that can react with NHS esters. Total RNA was extracted from HEK293T cells treated with preQ and/or queuine at the indicated concentrations for 24 h using TRIzol reagent (Thermo Fisher) according to the manufacturer's manual. Northern blot was performed as previously described. Briefly, 6 µg of total RNA from each sample was deacylated in 20 µl of 100 mM NaHCO/NaCO buffer (pH 9) at 37 °C for 30 min followed by purification using Zymo RNA Clean & Concentrator Kit (Zymo) and elution in 8 µl of sterile HO. Each deacylated sample was then split into two equal parts (4 µl each). 1 µl of 1 M NaHCO/NaCO (pH 9) buffer and 1 µl of 250 mM NHS ester, m(dPEG)-NHS (Thermo Fisher) or 1 µl dimethyl sulfoxide (DMSO; untreated control) was added to each sample, respectively. The mixture was then incubated at room temperature for 30 min, followed by the addition of an equal amount (6 µl) of 2× acidic denaturing RNA loading buffer (7 M urea, 0.03% (wt/vol) bromophenol blue, 0.03% (wt/vol) xylene cyanol, 12% (wt/vol) Ficoll, 2× Tris-borate-EDTA (TBE), 0.1 M NaOAc/HOAc, pH 4.8). All samples were loaded onto a pre-run 10% acidic urea-denaturing PAGE gel containing 100 mM NaOAc/HOAc, pH 4.8 for electrophoresis separation. The gel was run at constant power until the xylene cyanol band was ~4 cm from the bottom of the gel. The gel was then stained with 1× SYBR gold (Thermo Fisher) in 0.5× TBE buffer to check the RNA quality. The RNA was then transferred to a positively charged Nylon membrane (Cytiva Hybond-XL membrane) using a gel dryer (Bio-Rad) under vacuum or using a semi-dry transfer system (Bio-Rad). The gel-membrane assembly was separated by soaking in deionized water. The RNA was crosslinked to membrane under 254-nm UV light twice (120 mJ cm each time). The membrane was then blocked with hybridization buffer (20 mM phosphate, pH 7, 300 mM NaCl, 1% SDS) at room temperature for 30 min, followed by incubation with 200 pmol biotinylated DNA probe (IDT, Supplementary Table 3) against Q-tRNAs or control RNAs in 50 ml of hybridization buffer in a 60 °C hybridization oven (UVP) with rotation overnight. The membrane was washed twice with washing buffer (20 mM phosphate (pH 7.2), 300 mM NaCl, 2 mM EDTA, 0.1% SDS) for 30 min in a 60 °C hybridization oven. The membrane was then incubated with streptavidin-HRP (Genscript, 1:5,000-1:10,000 dilution) in 30 ml of hybridization buffer for 30 min at room temperature. followed by three 10-min washes in 30 ml of washing buffer. Signal detection was performed using ECL substrate (Bio-Rad) and a Bio-Rad ChemiDoc system. The membrane was stripped with boiling 1% SDS solution for 30 s and incubated at room temperature twice for 15 min. It was then re-probed with other tRNA northern probes.
APB gel-based northern blots were performed as reported in ref. . Briefly, 3 µg of cellular or mouse tissue total RNA with different preQ/queuine treatment was deacylated in 10 µl of 100 mM Tris-HCl buffer (pH 9) at 37 °C for 30 min. An equal amount (10 µl) of 2× denaturing RNA loading buffer (7 M urea, 0.03% (wt/vol) bromophenol blue, 0.03% (wt/vol) xylene cyanol, 12% (wt/vol) Ficoll, 2× TBE) was added to each sample. All samples were loaded onto a pre-run 10% denaturing PAGE gel with 0.5% (wt/vol) APB (Frontier Scientific). The gel was run at constant power in a cold room (4 °C) for ~2 h until the bromophenol blue bands came out. The gel was then stained with 1× SYBR gold, and the subsequent northern blot steps were performed as above.
Eight-week-old female C57BL/6J mice (n = 4) were injected intraperitoneally with 100 µl of either sterile saline or 10 mg ml preQ in sterile saline every 24 h for three consecutive days. At 24 h after the final injection, mouse tissues (liver, lung, kidney, heart) were collected, frozen and stored as previously described. Mice were anaesthetized with 2,2,2-tribromoethanol (250-500 mg kg; Thermo Fisher) and perfused transcardially with PBS containing 10 mM EDTA. Immediately after perfusion and dissection, tissues were placed in RNA-preserving solution (5.3 M ammonium sulfate, 25 mM sodium citrate, 20 mM EDTA) and kept at 4 °C overnight before transfer at -80 °C for storage.
Whole-tissue RNA extraction was performed as in ref. . Briefly, tissues stored in RNA-preserving solution were thawed and transferred to 2-ml tubes containing 700-1,500 µl (depending on tissue) of PureZOL (Bio-Rad). Tissues were lysed by adding 2.8-mm ceramic beads (OMNI International) and running 1-3 cycles of 5-45 s at 3,500 r.p.m. on a PowerLyzer 24 set-up (Qiagen). For liver, brain and small intestine samples, tissues were lysed in 3-5 ml using M tubes (Miltenyi Biotec) and running 1-4 cycles of the RNA_02.01 program on a gentleMACS Octo dissociator (Miltenyi Biotec). Next, lysates were processed in deep 96-well plates (USA Scientific) by adding chloroform for phase separation by centrifugation, followed by precipitation of total RNA in the aqueous phase using magnetic beads coated with silane (Dynabeads MyOne Silane, Thermo Fisher), RNA Lysis Buffer (buffer RLT, Qiagen) and ethanol. Genomic DNA contamination was removed by on-bead DNase I (Thermo Fisher) treatment at 37 °C for 20 min. After washing steps with 80% ethanol, RNA was eluted from the beads. This RNA extraction protocol was performed on a Bravo automated liquid handling platform (Agilent). Sample concentrations were measured using a Nanodrop One system (Thermo Scientific). RNA quality was confirmed using a Tapestation 4200 instrument (Agilent).
The xenograft experiment was performed as reported in ref. . Eight-week-old female C57BL/6J mice (n = 6 for control, n = 9 for preQ) were shaved in the abdominal area using a Wahl Bravmini clipper one day before tumour cell injection. Ovalbumin-expressing B16.F10 (B16-OVA) cells were cultured in DMEM supplemented with 10% dialysed FBS at 37 °C, thawed from cryopreserved stocks (90% FBS, 10% DMSO) and passaged twice. For preQ1 treatment, cells were incubated with 10 µM preQ1 for 12 h before injection.
A total of 1 × 10 B16-OVA cells in 100 µl of sterile saline were injected subcutaneously into the flank. Beginning on day 2, mice were administered 100 µl of either sterile saline or 2.5 mg ml preQ1, intraperitoneally, every other day. Tumour volumes were calculated using the formula ½ × major axis × (minor axis). Mice were euthanized upon ulceration or when tumours reached 1,000 mm.
Total RNA treated with preQ and/or queuine at concentrations as indicated in Fig. 4a for 24 h was extracted using TRIzol reagent, then 1 µg total RNA from each sample was used to build MSR-seq sequencing libraries as previously reported. For MSR-seq sequencing with ±PNK treatment, 1 µg of total RNA from each sample was treated with ±T4 PNK before adaptor ligation. The following MSR-seq steps were the same for all samples.
Polysome profiling was derived from a previously reported protocol with modifications. Briefly, 4 × 15-cm plates (5 × 10 cells plate) of 0Q HEK293T cells per sample were seeded three days before collection. preQ was added to half of the plates to 1 µM final concentration at the time of seeding cells and incubated for three days, and 1× PBS was added to the other half of the plates. On the day of collection, a 5-50% sucrose gradient was prepared in an ultracentrifuge tolerant tube (Seton) by combining 5% sucrose buffer (20 mM HEPES (pH 7.6), 100 mM KCl, 5 mM MgCl, 5% sucrose, 100 µg ml cycloheximide (CHX), 1% protease inhibitor (Roche, 11873580001), 1% RNase inhibitor (Thermo Fisher)) with 50% sucrose buffer (20 mM HEPES (pH 7.6), 100 mM KCl, 5 mM MgCl, 50% sucrose, 100 µg ml CHX, 1% protease inhibitor, 1% RNase inhibitor (Thermo Fisher)) using a gradient station (Biocomp). The sucrose gradient for all samples was stored in a cold room (4 °C) before use. Cells were then treated with 100 µg ml CHX (Fisher Scientific) in complete medium for 7 min at 37 °C, followed by an immediate wash with ice-cold PBS buffer containing 100 µg ml CHX twice. The cells were collected in 10 ml of ice-cold PBS buffer containing 100 µg ml CHX and pelleted by centrifugation at 500g for 5 min. Cells from 4 × 15-cm plates were combined as one sample, then four volumes of lysis buffer (20 mM HEPES (pH 7.6), 100 mM KCl, 5 mM MgCl, 1% Triton X-100, 100 µg ml CHX, 1% protease inhibitor, 1% RNase inhibitor) were added to the combined cell pellet and the cells were lysed on ice for 20 min with periodic perturbation (or rotating at 4 °C). The supernatant lysate of each sample was collected after centrifugation at 16,000g for 15 min, then 4 µl of Turbo DNase (Thermo Fisher) was added to the lysate and incubated at room temperature for 15 min. The lysate samples were centrifuged at 16,000g for 15 min after DNase treatment to remove any debris. The optical density at 260 nm (OD) of each lysate sample was measured using a NanoDrop set-up (Thermo Fisher). The OD values of all samples were adjusted to be the same using lysis buffer, then 20 µl of the lysate was saved for western blot validation. One-fifth of the lysate was saved as the input, and the total RNA was extracted using TRIzol reagent (Thermo Fisher). All the sucrose gradient tubes were weighed and balanced, and 500 µl of gradient solution was slowly removed from the top before loading. An equal amount (~500 µl) of the leftover four-fifths of lysate was slowly and horizontally added to the top of the gradient while gently rotating the tube. The gradient tubes were then centrifuged at 142,696g (28,000 r.p.m.) and 4 °C under vacuum for 3 h using an ultracentrifuge (Beckman Coulter Optima L-100XP, SW28.1 rotor). The sucrose gradient fractions (30 fractions, 590 µl each) were collected automatically using a sucrose gradient station and fraction collector (Gilson). All fractions were flash-frozen using liquid nitrogen before RNA extraction and western blot validation. A 400-µl aliquot from disome and above (polysome) fractions, as shown in Fig. 5a, was used to extract total RNA using TRIzol reagent. Total RNA from these fractions was combined for polysome mRNA extraction using a polyA+ RNA extraction kit (Promega) and sequencing. 1 µg total RNA from the input and polysome fractions was also used for MS for the detection of preQsine in the polysome.
Polysome mRNA-sequencing libraries were constructed using the MSR-seq protocol as described in ref. . Briefly, 400 ng input and polysome polyA+ RNA was fragmented at 94 °C for 3 min using a magnesium fragmentation buffer (NEB) to obtain ~300-nt fragment RNA. Fragment RNA larger than 200 nt was then purified using an RNA clean and concentrator kit (Zymo) and eluted in 8 µl of sterile HO. 1 μl of T4 PNK buffer and 1 µl of 10 U μl T4 PNK (NEB) were added to the fragment RNA and incubated at 37 °C for 30 min. T4 PNK was inactivated by incubation at 75 °C for 10 min followed by immediate incubation on ice. The entire reaction mixture (~10 μl) was used as the RNA input for MSR-seq. The MSR-seq libraries after polymerase chain reaction (PCR) amplification were purified using AMPure XP beads or gel.
0Q HEK293T cells were cultured in 2 × six-well plates to 60-70% confluency. Cells in 1 × 6-well plate were treated with 25 µg ml emetine or cycloheximide for 20 min. 1× PBS or preQ was then added to half of the wells in each six-well plate to 1 µM final concentration and incubated for 24 h. Cells were then collected, and total RNA was extracted. 3 µg total RNA from each sample was used for northern blot as described above.
0Q HEK293T cells were cultured to 60-70% confluency in 4 × six-well plates. Sterile HO or IRE1 ribonuclease inhibitor 4µ8C was added to eight wells of the six-well plates to 0 µM, 10 µM or 50 µM 4µ8C final concentration. For each IRE1 concentration, cells were treated with 1 µM preQ for 0 h, 8 h, 16 h or 24 h (duplicates). Cells from each treatment were then collected and total RNA were extracted using TRIzol reagent. 3 µg total RNA from each sample was then used to run a northern blot with preQsine detection as above.
0Q HEK293T cells were cultured to 60-70% confluency in 4 × six-well plates. Sterile HO, preQ or queuine was added to 1 µM final concentration to half of the wells in each six-well plate (triplicates) and incubated for 24 h. For thapsigargin (TG) positive control treatment, 2 h or 10 h before cell collection, TG was added to the corresponding wells to 1.5 µM final concentration.
Cells from 2 × six-well plates were collected, and total RNA was extracted using TRIzol reagent. For XBP1 mRNA splicing detection, reverse transcription (RT)-PCR followed by gel electrophoresis was performed. Briefly, 5 µg total RNA from each sample was diluted to 52 µl using sterile HO. 6 µl 10× Turbo DNase buffer and 2 µl Turbo DNase (Thermo Fisher) were added to each sample and mixed. The samples were incubated at 37 °C for 30 min. RNA was then purified using an RNA clean and concentrator-5 kit (Zymo) and eluted in 20 µl of sterile HO. The concentration of the eluted RNA samples was measured by a NanoDrop instrument, and 500 ng of total RNA from each sample was diluted to 9 µl in PCR tubes. 1 µl of 50 ng µl random hexamer and 1 µl of 10 mM dNTP mix were added to each sample and mixed. The samples were then incubated at 65 °C for 5 min followed by incubation on ice for >1 min. 9 µl of master cDNA synthesis mix containing 4 µl of 5× SuperScript IV (SSIV) RT buffer, 1 µl of 0.1 M dithiothreitol, 3.75 µl of sterile HO and 0.25 µl SSIV RT (200 U µl) were then added to each sample and mixed. The samples were incubated at 25 °C for 10 min followed by incubation at 55 °C for 60 min. RT was terminated by incubation at 80 °C for 10 min followed by immediate incubation on ice. PCR reactions were performed with 1 µl cDNA mix using Q5 High-Fidelity DNA Polymerase (NEB, M0491L) in 20 µl for 20 cycles (GAPDH) and 25 cycles (XBP1). The sizes of the PCR products of unspliced XBP1 and spliced XBP1 were 442 bp and 416 bp, respectively. The size of the PCR product of GAPDH control was 404 bp.
The primer sequences used for GAPDH and XBP1 were XBP1_F, 5' CCTTGTAGTTGAGAACCAGG, XBP1_R, 5' GGGGCTTGGTATATATGTGG, GAPDH_F, 5' GGATGATGTTCTGGAGAGCC, GAPDH_R, 5' CATCACCATCTTCCAGGAGC.
Cells from the other six-well plates were collected and whole-cell lysate was extracted using CelLytic M lysis buffer (Sigma, C2978). Whole-cell lysate from each sample (±preQ/queuine/TG treatment) was used to run a western blot as above to check the phosphorylation status of EIF2α. Antibodies for EIF2α (Cell Signaling Technology, 9722S, 1:1,000), phosphorylated EIF2α (Abcam, ab32157, 1:1,000), vinculin (Santa Cruz Biotechnology, sc-73614, 1:1,000) and IRE1 (Cell Signaling Technology, 3294S, 1:1,000) were used.
Polysome profiling after RNase digestion was derived from a previously reported protocol with modifications. Briefly, 2 × 15-cm plates (10 × 10 cells plate) of HEK293T 0Q cells per sample were seeded one day before collection. preQ was added to 4 × 15-cm plates to 1 µM final concentration at the time of seeding cells and incubated for 24 h, and 1× PBS was added to the other plates. At the time of collection, a 10-35% sucrose gradient was prepared in an ultracentrifuge tolerant tube (Seton) by combining 10% sucrose buffer (20 mM HEPES (pH 7.6), 100 mM KCl, 5 mM MgCl, 10% sucrose, 0.1% protease inhibitor, 0.1% phosphatase inhibitor) with 35% sucrose buffer (20 mM HEPES (pH 7.6), 100 mM KCl, 5 mM MgCl, 35% sucrose, 0.1% protease inhibitor, 0.1% phosphatase inhibitor) using a gradient station (Biocomp). The sucrose gradient for all samples was stored in a cold room (4 °C) before use. Cells in 4 × 15-cm plates were then treated with 1 µg ml emetine (positive control) for 15 min, followed by an immediate wash with ice-cold 1× PBS buffer. The cells were immediately collected with 10 ml of ice-cold 1× PBS and pelleted by centrifugation at 500g for 5 min. Cells from 2 × 15-cm plates were combined as one sample, then four volumes of lysis buffer (20 mM HEPES (pH 7.6), 100 mM KCl, 5 mM MgCl, 1% Triton X-100, 1% protease inhibitor, 1% phosphatase inhibitor) were added to the combined cell pellet and the cells lysed on ice for 20 min with periodic perturbation (or rotating at 4 °C). The supernatant lysate was collected after centrifugation at 16,000g for 15 min, then 4 µl of Turbo DNase (Thermo Fisher) was added to the lysate and incubated at room temperature for 15 min. The supernatant lysate was collected after centrifugation at 16,000g for 15 min after DNase treatment to remove any debris. The total RNA concentration in the lysate was measured using the Qubit RNA HS assay kit (Thermo Fisher, Q32852) after 20× dilution according to the manufacturer's manual. Lysate containing 90 µg of total RNA from each sample was used and adjusted to 500 µl using lysis buffer. 5 µl 100 mM CaCl was added to each sample to 1 mM final concentration. 1 µl of 100 U µl micrococcal nuclease (Thermo Fisher, 88216) was added to each sample and mixed. RNA digestion was performed for 40 min at 25 °C before the reaction was terminated by adding 10 µl SUPERaseIn RNase inhibitor (Thermo Fisher, AM2696). The RNase digested lysate from each sample (~516 µl) was loaded to the top of the sucrose gradient and fractionated by ultracentrifugation as for the normal polysome profile above. Fractions containing free RNA in the polysome were used for western blot analysis of ZAKα and ZNF598.
Ribosome profiling after RNase digestion was derived from a previously reported protocol with modifications. Cell culture and the following experiments until ultracentrifugation were performed as for the 'Sucrose gradient polysome profiles after RNase digestion' described above. For ribo-seq, lysate after RNase digestion (~516 µl) together with 8 ml of sucrose cushion buffer (20 mM HEPES (pH 7.6), 100 mM KCl, 5 mM MgCl, 0.1% SUPERaseIn RNase inhibitor (Thermo Fisher), 0.1% protease inhibitor, 0.1% phosphatase inhibitor) was loaded gently to the bottom of 70.1 Ti ultracentrifuge tubes (Beckman Coulter, 355603). 1.5 ml of 37.5% (1 M) sucrose buffer (20 mM HEPES (pH 7.6), 100 mM KCl, 5 mM MgCl, 37.5% sucrose, 0.1% SUPERaseIn RNase inhibitor (Thermo Fisher), 0.1% protease inhibitor, 0.1% phosphatase inhibitor) was loaded gently to the bottom of the tube using a long blunt-ended needle. All the ultracentrifuge tubes were weighed and balanced. The tubes were then centrifuged at 387,331g (65,000 r.p.m.) and 4 °C under vacuum for 2.5 h using an ultracentrifuge (Beckman Coulter Optima L-100XP, 70.1 Ti rotor). The ribosome pellet was washed with 2 ml of sucrose cushion buffer three times after removing the supernatant. 1 ml of TRIzol reagent was directly added to the ribosome pellet and incubated at room temperature for 10 min or until the ribosome pellet was completely dissolved. The TRIzol ribosome mixture was then transferred to microcentrifuge tubes and total RNA was extracted according to the manufacturer's manual. 5 µg of RNA from each sample was loaded on a 10% TBE-urea gel for RPF extraction. For both monosome and disome protected fragments, the gel region containing RNA from 15 to 40 nt and 50 to 80 nt was excised from the gel and transferred to microcentrifuge tubes. The gel slices were crushed into tiny pieces using pipette tips or a disposable homogenizer pestle, then 400 µl of RNA gel extraction buffer (300 mM NaOAc, pH 5.2, 1 mM EDTA, 0.25% SDS) was added to the gel pieces and flash-frozen by liquid nitrogen. The samples were then mixed end-to-end on a rotary mixer at room temperature for 12-20 h. The gel pieces mixture was transferred to a 0.22-µm filter inserted into a 1.5-ml microcentrifuge tube (Corning Spin-X Centrifuge Tube Filters, 8160) using wide-bore tips. The samples were centrifuged at 10,000g at 4 °C for 1 min. The cleared elute was transferred to new microcentrifuge tubes. 3 µl of GlycoBlue and 500 µl of isopropanol were added to each sample and thoroughly mixed followed by incubation in a -20 °C freezer overnight. The samples were then centrifuged at 17,000g at 4 °C for 30 min to pellet the RNA. The RNA pellets were washed with 1 ml of 75% ethanol followed by centrifugation at 4 °C for 3 min. The supernatant was completely removed and RNA pellets were air-dried for 10 min at room temperature. RNA was resuspended in 41 µl of HO and the concentrations were measured using a Qubit RNA HS assay kit (Thermo Fisher).
A 5-µl volume of 10× T4 PNK buffer A and 5 µl of T4 PNK (Thermo Fisher, EK0032) were added to the RPF RNA from above (~40 µl), then mixed. The samples were incubated at 37 °C for 20 min, then 6 µl of 10 mM ATP, 1 µl of 10× T4 PNK buffer A and 3 µl of T4 PNK were added to each sample (~60 µl total) and mixed, followed by incubation at 37 °C for 20 min. RNA binding buffer (120 µl) and 270 µl of 100% ethanol were added to each sample, followed by RNA purification using RNA Clean & Concentrator-5 (Zymo, R1016). The purified RNA samples were then used for sequencing library construction using an NEBNext Multiplex Small RNA Library Prep Set for Illumina (NEB, E7300S) according to the manufacturer's manual. rRNA blocker oligos (Nanodigmbio, 1002901) were added at the RT primer hybridization step during library construction to reduce rRNA reads. Sequencing libraries were sequenced on an Illumina NextSeq system using a single-end kit (Illumina, 20100995).
A SUnSET translation activity assay was performed as previously reported with modifications. Briefly, 3 × six-well plates (0.3 × 10 cells well) of HEK293T cells were seeded for cycloheximide, emetine and mock treatment (1 × six-well plate for each condition). The cells were incubated at 37 °C in a CO incubator to reach ~70% confluency. Cycloheximide, emetine or HO/ethanol control were added to the cells to 100 µg ml or 25 µg ml, respectively, followed by incubation for 20 min. For each treatment, preQ or 1× PBS was then added to three wells of cells to 1 µM final concentration and incubated for 24 h. Puromycin was added to all wells to 10 µg ml final concentration and incubated for 30 min. The medium was then replaced with prewarmed medium without puromycin followed by incubation for 30 min. The cells were collected using ice-cold 1× PBS. Whole-cell lysate was extracted using CelLytic M lysis buffer (Sigma, C2978) and used to run a western blot with anti-puromycin antibody (Sigma, MABE343, 1:25,000). β-actin (Santa Cruz Biotechnology, sc-47778, 1:1,000) was used as the loading control. The entire blot was stained with Coomassie blue to visualize protein loading.
SiRNAs for IRE1 were obtained from Sigma Mission predesigned siRNA collections. MISSION siRNA Universal Negative Control #1 was used as siRNA control (sequence proprietary to Sigma). The two siRNA sequences are as follows:
IRE1 KD by siRNAs was performed using a reverse transfection method with Lipofectamine RNAiMAX (Thermo Fisher, 13778150) according to the manufacturer's manual. Briefly, 120 pmol of siRNA was diluted in 2 ml of Opti-MEM I reduced serum medium (Thermo Fisher, 31985070) in a 10-cm tissue culture plate, then 20 µl of Lipofectamine RNAiMax was added to each plate and mixed, followed by incubation at room temperature for 10-15 min. 0Q HEK293T cells were collected and resuspended in complete DMEM without antibiotics at the same time. The cells were then counted, and 1.5 × 10 cells were added to each plate. Complete DMEM without antibiotics was then added to each plate to 10 ml. The cells were incubated in a 37 °C cell incubator for 3-4 days. The initial siRNA KD steps depleted the target genes at the beginning of the northern blot analysis. Cells from the initial KD were collected and resuspended in complete DMEM without antibiotics and counted. Twenty percent of the cells were saved for protein lysate extraction and western blot analysis of IRE1 KD efficiency. At the same time, 40 pmol of siRNA was diluted in 500 µl of Opti-MEM I reduced serum medium in each well of the six-well plate, then 5 µl of Lipofectamine RNAiMax was added to each well followed by incubation at room temperature for 10-15 min. A total of 3.75 × 10 cells in 2.5 ml of complete DMEM without antibiotics from each initial KD experiment were added to the corresponding wells of six-well plates and incubated for 2-3 days until 60-70% confluency. Sterile HO or preQ was added to the each well to 1 µM final concentration followed by incubation for 24 h. The cells were then collected and total RNA extracted using TRIzol reagent; 3 µg of the total RNA from each sample was used for northern blot analysis of tRNA levels as described above.
0Q HEK293T cells were cultured to 60-70% confluency in 4 × six-well plates. Sterile HO, preQ or queuine was added to 1 µM final concentration to the wells in each six-well plate (triplicates) and incubated for 24 h. For TG-positive control treatment, 2 h before cell collection TG was added to corresponding wells to a 1.5 µM final concentration. The cells were collected and whole-cell lysate was extracted using CelLytic M lysis buffer (Sigma, C2978) supplemented with 1% protease inhibitor and 1% phosphatase inhibitor. The whole-cell lysate from each sample (±preQ/queuine/TG treatment) was used to run a western blot as above to check the phosphorylation status of IRE1. Antibodies for IRE1 (Cell Signaling Technology, 3294S, 1:1,000), phosphorylated IRE1 (Abcam, ab243665, 1:1,000) and GAPDH (Santa Cruz Biotechnology, sc-47724-HRP, 1:200) were used.
Blue native PAGE followed by western blot was performed as previously reported. Briefly, 2 × six-well plates (0.8 × 10 cells well) of HEK293T 0Q cells were seeded 24 h before collection. Sterile HO, preQ or queuine was added to three wells to a 1 µM final concentration at the time of seeding, followed by incubation for 24 h. For TG positive control treatment, 2 h before cell collection, TG was added to three corresponding wells to 1.5 µM final concentration. The cells were collected using ice-cold 1× PBS, and the cell lysate was extracted using 50 µl of 2% digitonin cell lysis buffer per sample (50 mM Bis-Tris pH 7, 2% digitonin, 1× Roche protease inhibitor cocktail, 100 mM NaCl, 10% glycerol) after complete removal of 1× PBS. The cells were lysed on ice with periodic inversion or rotation at 4 °C for 45 min, then 50 µl of cell lysate dilution buffer (50 mM Bis-Tris pH 7, 1× Roche protease inhibitor cocktail, 10% glycerol) was added to each sample followed by mixing with inversion several times. Supernatant lysate was collected by centrifugation at 17,000g and 4 °C for 30 min.
A 6.25-µl volume of lysate from each sample was mixed with 2.5 µl 4× Native PAGE sample buffer (Thermo Fisher, BN2003) and 1.25 µl Native PAGE 5% G-250 sample additive (Thermo Fisher, BN2004), followed by mixing with brief vortexing. Samples together with native protein ladder (Thermo Fisher, LC0725) were then loaded on 3-12% Native PAGE Bis-Tris gel (Thermo Fisher, BN1003BOX). One empty lane was kept between the native protein ladder and samples for easy protein imaging after gel electrophoresis. The native gel was run according to the manufacturer's manual. Briefly, 1× Native PAGE anode buffer was prepared by mixing 50 ml of 20× Native PAGE running buffer (Thermo Fisher, BN2001) and 950 ml of deionized water. 1× Native PAGE Dark Blue cathode buffer was prepared by mixing 50 ml of 20× Native PAGE running buffer and 50 ml of 20× Native PAGE cathode additive (Thermo Fisher, BN2002) with 900 ml of deionized water. 1× Native PAGE Light Blue cathode buffer was prepared by mixing 50 ml of 20× Native PAGE running buffer and 5 ml 20× Native PAGE cathode additive (Thermo Fisher, BN2002) with 945 ml of deionized water. Blue native gel was run at 150 V for 1 h using 1× Native PAGE anode buffer and 1× Native PAGE Dark Blue cathode buffer at room temperature. The cathode buffer was then changed to 1× Native PAGE Light Blue cathode buffer. The gel was run at 150 V for 4 h in the cold room (4 °C). After gel electrophoresis, the native protein ladder was cut out of the gel for Coomassie blue staining and the gel containing samples was incubated with 1× Tris/glycine/SDS transfer buffer without methanol (Bio-Rad, 1610732) for 60 min. The Coomassie blue-stained native protein ladder lane and the gel were aligned on methanol-activated and 1× Tris/glycine/SDS transfer buffer-rinsed PVDF membrane. The native protein ladder bands were marked on the PVDF membrane for size reference. Semi-dry transfer was performed at 25 V (constant V) for 23 min using a Trans-Blot Turbo Transfer System (Bio-Rad, 1704150). The membrane was then fixed with 8% acetic acid for 15 min, followed by washing three times with 1× TBST for 10 min each. The membrane was then processed using Pierce western blot signal enhancer (Thermo Fisher, 21050) according to the manufacturer's manual to enhance the signal. A regular western blot protocol was followed afterwards. Antibody for IRE1 (Abcam, ab322061, 1:1,000) was used.
MSR-seq reads were first mapped to a reference genome composed of bacterial 5S rRNA sequences. Reference sequences for 5S rRNA were downloaded from the 5S rRNA database (https://project.iith.ac.in/sharmaglab/rrnadatabase/). Sequences were combined from bacteria (n = 7,291), Archaea (n = 319), Eukaryota (n = 2,861), mitochondria (n = 110) and plastids (n = 838). Full lineages were assigned to each reference using the ETE3 NCBI Taxa toolkit in Python. From there, tRNA reference genomes were retrieved from gtRNAdB for microbes from the most abundant class taxon: Lachnoclostridium_phytofermentans_ISDg, Erysipelothrix_rhusiopathiae_SY1027, Carnobacterium_maltaromaticum, Faecalibacterium_prausnitzii, Bacteroides_dorei, Bifidobacterium_longum_subsp_longum_BBMN68, Clostridium_beijerinckii, Roseburia_intestinalis_XB6B4 and Ruminococcus_bromii_L2-63. These reference tRNA genomes were combined into a single reference fasta, and tRNA-seq reads were mapped to this combined reference. Q-tRNA modification was detected by its characteristic deletion signatures. Further analysis was performed with custom R scripts (available on GitHub, https://github.com/ckatanski/preQ1). Python 3.10.10, along with the pandas (v1.5.2) and numpy (v1.24.3) libraries, was used for data wrangling and preprocessing.
Data analysis was performed as described in ref. . Briefly, starting from index demultiplexed fastq data, paired end reads were split by internal barcode sequence using Je demultiplex with the options BPOS = BOTH BM = READ 1 LEN = 4:6 FORCE = true C = false 6. Barcode sequences are available on GitHub at https://github.com/ckatanski/Q_paper ref. . Next read two files were used to map with bowtie2, with the following parameters: -q -p 10 -local --no-unal. Reads were mapped to a curated list of non-redundant tRNA mature genes with tRNAScane score >40 from hg19. Bowtie2 output sam files were converted to bam files, then sorted using samtools. Next, Integrative Genomics Viewer (IGV) was used to collapse reads into 1-nt windows. IGV output.wig files were reformatted using custom Python scripts (available on GitHub at https://github.com/ckatanski/Q_paper). The bowtie2 output Sam files were also used as input for a custom Python script using PySam, a Python wrapper for SAMTools, to sum all reads that mapped to each gene. For tRNA fragment analysis, related custom scripts were used to divide reads based on which 10-nt window the 3' end mapped to for each tRNA. Data were visualized with custom R scripts. All custom scripts are available on GitHub (https://github.com/ckatanski/CHRIS-seq). R script for the present analysis is available on GitHub (https://github.com/ckatanski/preQ1). Relative tRNA expression levels were calculated as the ratio of reads of a tRNA divided by the total number of reads. The expression level of an isoacceptor is the sum of expression levels of all isodecoders. The mean expression level of the two replicates was used for visualization.
Paired-end reads for input and polysome-associated mRNA were split by internal barcode sequence using Je demultiplex with the options BPOS = BOTH BM = READ 1 LEN = 4:6 FORCE = true C = false 6. The barcode sequences are available on GitHub at https://github.com/ckatanski/Q_paper ref. . The quality of reads was checked by fastqc v0.11.9 and the reads were aligned to the human hg38 genome (GRCh38.p13.genome.fa) by STAR 2.7.9a with the human annotation file (gencode.v39.annotation.gtf) from the GENCODE database (https://www.gencodegenes.org). The expression levels were counted and collected by RSEM v1.3.3/featureCounts. Low-expressed genes were filtered by the filterByExpr function with default parameters in edgeR v3.36.0 and the CPM (counts per million reads mapped) and TPM (transcripts per million) of each gene were calculated. The TPM in visualization was the mean of the two replicates. TE was calculated using DESeq2/EdgeR with the raw reads count. In essence, the TE of a gene was calculated as the normalized polysome-associated mRNA reads count in the polysome sample divided by the normalized input mRNA reads count in the input sample. For ribo-seq, the normalized RPF reads count was divided by the input mRNA reads count to obtain TE. Codon usage of a gene or a group of genes was defined as the ratio of each amino acid within the CDS region of a gene or a group of genes. GO analysis was performed using the GO Resource (http://geneontology.org).
Trimmomatic was used to remove NEBNext small library adaptors, primer dimers and poly-G sequences and filter out low-quality reads from the raw sequencing reads. Cutadapt was used to further trim adaptors from the sequencing reads. Reads less than 10 nt were removed during both adaptor trimming steps. The trimmed reads were first mapped to the human rRNA, tRNA and noncoding RNA combined reference (Homo_sapiens.GRCh38.ncrna.fa.gz, Ensembl) using bowtie2, saving the unmapped reads. The unmapped reads were then mapped to the human hg38 genome (Homo_sapiens.GRCh38.dna.primary_assembly.fa) using STAR with the human annotation file (Homo_sapiens.GRCh38.113.gtf) from the Ensembl database (https://www.ensembl.org). The mapped bam files were then sorted and indexed using samtools. The resulting bam files were then analysed using Ribo-TISH to obtain the RPF sequence length distribution. Ribosome occupancy analysis was performed using CONCUR. TE analysis, codon usage analysis and GO analysis were performed as a polysome profiling data analysis.
All unique/stable reagents generated in this study, including stable cell lines and queuine and preQ derivatives and so on are available from the lead contact with a complete Materials Transfer Agreement.
Further information on research design is available in the Nature Portfolio Reporting Summary linked to this Article.